Workflow Type: Galaxy

RNA-seq single-read Workflow

Inputs dataset

  • The workflow needs a list of dataset of fastqsanger.

  • As well as a gtf file with genes

  • Optional, but recommended: a gtf file with regions to exclude from normalization in Cufflinks.

    • For instance a gtf that masks chrM for the mm10 genome:
chrM	chrM_gene	exon	0	16299	.	+	.	gene_id "chrM_gene_plus"; transcript_id "chrM_tx_plus"; exon_id "chrM_ex_plus";
chrM	chrM_gene	exon	0	16299	.	-	.	gene_id "chrM_gene_minus"; transcript_id "chrM_tx_minus"; exon_id "chrM_ex_minus";

Inputs values

  • forward adapter sequence: this depends on the library preparation. Usually classical RNA libraries are Truseq and ISML (relatively new Illumina library) is Nextera. If you don't know, use FastQC to determine if it is Truseq or Nextera. If the read length is relatively short (50bp), there is probably no adapter.
  • reference_genome: this field will be adapted to the genomes available for STAR
  • strandness: For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence. This will help you to get from STAR only the counts corresponding to your library preparation. This is also used for the stranded coverage and for FPKM computation with cufflinks.

Processing

  • The workflow will remove adapters and low quality bases and filter out any read smaller than 15bp
  • The filtered reads are mapped with STAR with ENCODE parameters (for long RNA-seq but I use it for short also). STAR is also used to count reads per gene.
  • A multiQC is run to have an overview of the QC. This can also be used to get the strandness.
  • FPKM values for reads and transcripts are computed with cufflinks using correction for multi-mapped reads.
  • The BAM is filtered to keep only uniquely mapped reads (tag NH:i:1).
  • Coverage unstranded, and each strand independently is computed with bedtools and normalized to the number of million uniquely mapped reads.
  • The three coverage files are converted to bigwig.

Warning

  • The coverage stranded output depends on the strandness of the library:
    • If you have an unstranded library, stranded coverages are useless
    • If you have a forward stranded library, the label matches the orientation of reads.
    • If you have a reverse stranded library, positive strand coverage should correspond to genes on the forward strand and uses the reads mapped on the reverse strand. negative strand coverage should correspond to genes on the reverse strand and uses the reads mapped on the forward strand.

Contribution

@lldelisle wrote the workflow and the tests.

@nagoue updated the tools, made it work in usegalaxy.org, fixed some best practices.

Inputs

ID Name Description Type
SR fastq input SR fastq input Should be a list of single-read RNA-seq fastqs
  • File[]
forward_adapter forward_adapter Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
gtf gtf gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming
  • File
gtf with regions to exclude from FPKM normalization gtf with regions to exclude from FPKM normalization Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse
  • File?
reference_genome reference_genome reference_genome
  • string
strandness strandness For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
  • string

Steps

ID Name Description
6 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.0+galaxy1
7 get reference_genome as text parameter toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1
8 awk command from strand toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
9 bedtools orientation for forward coverage toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
10 bedtools orientation for reverse coverage toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
11 Get cufflinks strandess parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.1.1
12 STAR: map and count toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.8a+galaxy0
13 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy0
14 Extract gene counts toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2
15 Keep only uniquely mapped reads toolshed.g2.bx.psu.edu/repos/devteam/bamtools_filter/bamFilter/2.5.1+galaxy0
16 get scaling factor This step get 1 / millions of uniquely mapped reads toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/1.1.2
17 Compute FPKM toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3
18 convert dataset to parameter param_value_from_file
19 Scaled Coverage both strands combined toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
20 Scaled Coverage positive toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
21 Scaled Coverage negative toolshed.g2.bx.psu.edu/repos/iuc/bedtools/bedtools_genomecoveragebed/2.30.0
22 convert both strands coverage to bigwig wig_to_bigWig
23 convert positive coverage to bigwig wig_to_bigWig
24 convert negative coverage to bigwig wig_to_bigWig

Outputs

ID Name Description Type
output_log output_log n/a
  • File
reads_per_gene from STAR reads_per_gene from STAR n/a
  • File
mapped-reads mapped-reads n/a
  • File
MultiQC webpage MultiQC webpage n/a
  • File
MultiQC on input dataset(s): Stats MultiQC on input dataset(s): Stats n/a
  • File
HTS count like output HTS count like output n/a
  • File
transcripts_expression transcripts_expression n/a
  • File
genes_expression genes_expression n/a
  • File
both strands coverage both strands coverage n/a
  • File
positive strand coverage positive strand coverage n/a
  • File
negative strand coverage negative strand coverage n/a
  • File

Version History

v1.5 (latest) Created 7th Jul 2026 at 03:01 by WorkflowHub Bot

Updated to v1.5


Frozen v1.5 c63af7d

v1.4 Created 26th Jun 2026 at 03:01 by WorkflowHub Bot

Updated to v1.4


Frozen v1.4 93e2d52

v1.3 Created 18th Feb 2026 at 03:01 by WorkflowHub Bot

Updated to v1.3


Frozen v1.3 b839c96

v1.2 Created 29th Jan 2025 at 03:02 by WorkflowHub Bot

Updated to v1.2


Frozen v1.2 4dfaa02

v1.1 Created 26th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.1


Frozen v1.1 49929d3

v1.0 Created 20th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.0


Frozen v1.0 96e4475

v0.9 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 26e44e5

v0.6 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 2465702

v0.8 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 ee9034e

v0.7 Created 29th Jun 2024 at 03:02 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 59f2b7e

v0.5 Created 16th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 ac353d9

v0.4.1 Created 15th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4.1


Frozen v0.4.1 5228c14

v0.4 Created 17th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 f49c5a7

v0.2 Created 1st Dec 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 28b9493

v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 30a19f3
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
Activity

Views: 17764   Downloads: 61371   Runs: 3

Created: 22nd Oct 2022 at 03:01

Last updated: 17th Jan 2023 at 03:01

Annotated Properties
Scientific disciplines
Computer Science
help Tags
help Attributions

None

Total size: 65.1 KB
Powered by
(v.1.18.0)
Copyright © 2008 - 2026 The University of Manchester and HITS gGmbH